View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0059_high_3 (Length: 281)
Name: NF0059_high_3
Description: NF0059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0059_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 26315764 - 26315575
Alignment:
| Q |
1 |
caatcaactctttcccatcatgccattgaactatctcatggtaagcctttgatttactcgaacatttgtgttttatgctctannnnnnnncaaatgatat |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26315764 |
caatcaactctttcccaccatgccattgaactatctcatggtaagcctttgatttactcgaacatttgtgttttatgctctattttttttcaaatgatat |
26315665 |
T |
|
| Q |
101 |
atctctttgccccctctaatctattc-----taatataatataatataatctacattgtgtttatatgacataaatattatctaaccctc |
185 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26315664 |
atctttttgccccctctaatctattctaatataatataatataatataatctacattgtgtttatatgacataaatattaactaaccctc |
26315575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1462 times since January 2019
Visitors: 1299