View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0060-INSERTION-2 (Length: 108)
Name: NF0060-INSERTION-2
Description: NF0060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0060-INSERTION-2 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 3e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 2902428 - 2902535
Alignment:
| Q |
1 |
catgccaaccctaccttcgaagataaacacatgaactcatcgatggatatgcttgcaacaaatatggattgtttcccctcttccagtaccgttacttacg |
100 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
2902428 |
catgccaaccttaccttcgcagataaacacatgaactcatcgatggatatgcttgcaacaaatatggattgtttcccttcttccagtactgttacttacg |
2902527 |
T |
 |
| Q |
101 |
aggcctat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
2902528 |
aggcctat |
2902535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 53 - 108
Target Start/End: Original strand, 2906595 - 2906650
Alignment:
| Q |
53 |
ttgcaacaaatatggattgtttcccctcttccagtaccgttacttacgaggcctat |
108 |
Q |
| |
|
|||| |||||||||||||||||||| |||| ||||| |||||||| ||| ||||| |
|
|
| T |
2906595 |
ttgctacaaatatggattgtttccctccttctagtactgttacttatgagccctat |
2906650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University