View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0060-INSERTION-2 (Length: 108)

Name: NF0060-INSERTION-2
Description: NF0060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0060-INSERTION-2
NF0060-INSERTION-2
[»] chr5 (2 HSPs)
chr5 (1-108)||(2902428-2902535)
chr5 (53-108)||(2906595-2906650)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 3e-45; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 2902428 - 2902535
Alignment:
1 catgccaaccctaccttcgaagataaacacatgaactcatcgatggatatgcttgcaacaaatatggattgtttcccctcttccagtaccgttacttacg 100  Q
    |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||    
2902428 catgccaaccttaccttcgcagataaacacatgaactcatcgatggatatgcttgcaacaaatatggattgtttcccttcttccagtactgttacttacg 2902527  T
101 aggcctat 108  Q
    ||||||||    
2902528 aggcctat 2902535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 53 - 108
Target Start/End: Original strand, 2906595 - 2906650
Alignment:
53 ttgcaacaaatatggattgtttcccctcttccagtaccgttacttacgaggcctat 108  Q
    |||| ||||||||||||||||||||  |||| ||||| |||||||| ||| |||||    
2906595 ttgctacaaatatggattgtttccctccttctagtactgttacttatgagccctat 2906650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University