View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0060-INSERTION-6 (Length: 174)
Name: NF0060-INSERTION-6
Description: NF0060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0060-INSERTION-6 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 21492417 - 21492590
Alignment:
| Q |
1 |
aaaagagtcagagaaaggacaacaccggttaaactaatcaatgcaagtttcttcctcccagttttgtcgatgaaatatatgctcagaattgaaccgaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21492417 |
aaaagagtcagagaaaggacaacaccggtcaaactaatcaatgcaagtttcttcctcccagttttgtcgatgaaatatatgctcagaattgaaccgaatg |
21492516 |
T |
|
| Q |
101 |
cattgaggccagaagtgattagagacagaagaagtgctgttctttttgacgcaaaaccggccagctgaacaatt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21492517 |
cattgaggccagaagtgattagagacagaagaagtgctgttctttttgacgcaaaaccggccagctgaacaatt |
21492590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 158
Target Start/End: Original strand, 21559146 - 21559259
Alignment:
| Q |
45 |
aagtttcttcctcccagttttgtcgatgaaatatatgctcagaattgaaccgaatgcattgaggccagaagtgattagagacagaagaagtgctgttctt |
144 |
Q |
| |
|
|||||||||||| || || |||||||| || |||||||||| ||| ||||| |||||||| | |||| |||| || |||||||||||||||||| | |
|
|
| T |
21559146 |
aagtttcttccttccggtcttgtcgataaagtatatgctcaaaatcgaaccaaatgcattaattccagctgtgacgagcgacagaagaagtgctgttttg |
21559245 |
T |
|
| Q |
145 |
tttgacgcaaaacc |
158 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
21559246 |
tttgatgcaaaacc |
21559259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.0000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.0000000009
Query Start/End: Original strand, 31 - 131
Target Start/End: Complemental strand, 33116403 - 33116303
Alignment:
| Q |
31 |
aaactaatcaatgcaagtttcttcctcccagttttgtcgatgaaatatatgctcagaattgaaccgaatgcattgaggccagaagtgattagagacagaa |
130 |
Q |
| |
|
||||||||||| || || ||||| ||||| ||||| ||||||||||||||||| | || ||||| || ||||| | |||| |||||| |||||||||| |
|
|
| T |
33116403 |
aaactaatcaaagctagcttctttctcccggttttatcgatgaaatatatgcttataagagaaccaaacgcattcaacccagcagtgataagagacagaa |
33116304 |
T |
|
| Q |
131 |
g |
131 |
Q |
| |
|
| |
|
|
| T |
33116303 |
g |
33116303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 768 times since January 2019
Visitors: 1284