View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0062_low_10 (Length: 355)
Name: NF0062_low_10
Description: NF0062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0062_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 98 - 334
Target Start/End: Complemental strand, 14977457 - 14977221
Alignment:
| Q |
98 |
catcagtgtaacattacaaacatgttcaaacgttgttagaatcgaaaatagaatctaccaaagaagtaaaaattgaaacttttaaggttttgaagcatgc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14977457 |
catcagtgtaacattacaaacatgttcaaacgttgttagaatcgaaaatagaatctaccaaagaagtaaaaattgaaacttttaaggttttgaagcatgc |
14977358 |
T |
|
| Q |
198 |
ccattctgttacctttgaaaaatttcgacgagttccaccttctagatccataacatgcgaggtttttgaagtttcaaagaaccatgnnnnnnnnngtttt |
297 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14977357 |
ccattctgttacctttgaagaatttcgacgagttccaccttctagatccataacatgcgaggtttttgaagtttcaaagaaccatgtttttttttgtttt |
14977258 |
T |
|
| Q |
298 |
ctggaacaaagaatttaaggtttttgttttgatgatg |
334 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14977257 |
ctggaaccaagaatttaaggtttttgttttgatgatg |
14977221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1159 times since January 2019
Visitors: 1293