View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0062_low_11 (Length: 328)
Name: NF0062_low_11
Description: NF0062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0062_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 144 - 233
Target Start/End: Original strand, 409280 - 409369
Alignment:
| Q |
144 |
caactccaacacttttggaaccatacccaacaacattaaactctctcatgctaactctcaacaacgttgttttgtggtcaacagtgtttt |
233 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
409280 |
caactccaacacttttggaatcatacccaacaacattaaactctctcatgctaactctcaacaacgttgttttatggtcaacagtgtttt |
409369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1452 times since January 2019
Visitors: 1299