View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0062_low_12 (Length: 320)
Name: NF0062_low_12
Description: NF0062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0062_low_12 |
 | |
|
| [»] scaffold0191 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0191 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 30 - 261
Target Start/End: Original strand, 20328 - 20565
Alignment:
| Q |
30 |
aatagaggatgttgattagatcggttcatattttttggtggtgtcaacatcatttacttttgtacttccaatgtaaattttacattttatatagaacaaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||| |||||||||||||| | |
|
|
| T |
20328 |
aatagaggatgttgattagatcggttcatattttttggtggtgtcaacatcttttatttttgtacttccaatgtgaattttgcattttatatagaatgca |
20427 |
T |
|
| Q |
130 |
atgacatttgatcgaaatgggtctaatgttatttgaagaaaaggt--------gagaggacctttagaattgatatagtcttgtcttaactttgaattta |
221 |
Q |
| |
|
| ||||||||||||||||||| |||||||| |||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
20428 |
a--acatttgatcgaaatgggtgtaatgttacttgacgaaaaggtgagaacaagagaggacctttagaattgatatagtcttggcttaactttgaatcta |
20525 |
T |
|
| Q |
222 |
tgatggatgaaatttgagaatagaaatattttcagaatct |
261 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20526 |
tgatgggtgaaatttgagaatagaaatattttcagaatct |
20565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 159 - 261
Target Start/End: Complemental strand, 10440399 - 10440297
Alignment:
| Q |
159 |
tatttgaagaaaaggtgagaggacctttagaattgatatagtcttgtcttaactttgaatttatgatggatgaaatttgagaatagaaatattttcagaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
10440399 |
tatttgaagaaaaggtgagaggacctttagaattgatatagtcttggcttaattttgaatctatgatgggtgaaatttgagaatagaaatatttttagaa |
10440300 |
T |
|
| Q |
259 |
tct |
261 |
Q |
| |
|
||| |
|
|
| T |
10440299 |
tct |
10440297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 10440462 - 10440426
Alignment:
| Q |
30 |
aatagaggatgttgattagatcggttcatattttttg |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10440462 |
aatagaggatgttgattagatcggttcatattttttg |
10440426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1241 times since January 2019
Visitors: 1296