View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0062_low_13 (Length: 298)
Name: NF0062_low_13
Description: NF0062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0062_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 40546507 - 40546276
Alignment:
| Q |
1 |
gggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgcatctgctagtaaggaagcagataagttacaaccaacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40546507 |
gggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgcatctgctagtaaggaagcagataagttacaaccaacaaa |
40546408 |
T |
|
| Q |
101 |
gtcacaaaaattgcttttaagacaaatataagttactgccaaccaagttattgtgaagaataacagtttgagccggtgcnnnnnnngttgcataaaaacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40546407 |
gtcacaaaaattgcttttaagacaaatataagttactgccaaccaagttattgtgcagaataacagtttgagccggtgcaaaaaaggttgcataaaaacc |
40546308 |
T |
|
| Q |
201 |
atcttcaacctaccaagacagattagtatatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40546307 |
atcttcaacctaccaagacagattagtatatg |
40546276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 189 - 235
Target Start/End: Complemental strand, 31790894 - 31790848
Alignment:
| Q |
189 |
tgcataaaaaccatcttcaacctaccaagacagattagtatatggat |
235 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31790894 |
tgcataaaaactgccttcaacctaccaagacagattagtatatggat |
31790848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 286
Target Start/End: Complemental strand, 40546260 - 40546232
Alignment:
| Q |
258 |
catggaaaatttgagaactatatcattca |
286 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40546260 |
catggaaaatttgagaactatatcattca |
40546232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1461 times since January 2019
Visitors: 1299