View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0062_low_17 (Length: 233)
Name: NF0062_low_17
Description: NF0062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0062_low_17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 233
Target Start/End: Original strand, 7100175 - 7100398
Alignment:
| Q |
10 |
cattgtttatcttcactttcaacaacccaaaatcatagtttctggaaaattcctcagctatctcatttagtactcatgatacacacttgaaagatttgtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7100175 |
cattgtttatcttcactttcaacaacccaaaatcatagtttctggaaaattcctcagctatctcatttagtactcatgatacacacttgaaagatttgtt |
7100274 |
T |
|
| Q |
110 |
tcacatagatggggccacttattatgaattcaacatgaaaagtgaaacaaataataaggcaaccaaaacctatatatatgtagagcaatccaaagacaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
7100275 |
tcacatagatggggccacttattatgaattcaacatgaaaagtgaaacaaataataaggcaaccaaaacctatatacatgtagagcaatccagagacaat |
7100374 |
T |
|
| Q |
210 |
gataaatatagtaaaacaaaactt |
233 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
7100375 |
gataaatagagtaaaacaaaactt |
7100398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1171 times since January 2019
Visitors: 1293