View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0062_low_19 (Length: 207)
Name: NF0062_low_19
Description: NF0062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0062_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 49910432 - 49910553
Alignment:
| Q |
1 |
taggttttactcgtaaatgattctcctctttgcccggattcctagtaatgcgtagaattgatttcagagcaattggttcaagatgaaattgattatattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910432 |
taggttttactcgtaaatgattctcctctttgcccggattcctagtaatgcgtagaattgatttcagagcaattggttcaagatgaaattgattatattt |
49910531 |
T |
|
| Q |
101 |
ttatctcgtgttcacagatggg |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49910532 |
ttatctcgtgttcacagatggg |
49910553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1304 times since January 2019
Visitors: 1296