View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063-2-Insertion-10 (Length: 310)
Name: NF0063-2-Insertion-10
Description: NF0063-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063-2-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 33 - 310
Target Start/End: Complemental strand, 4050636 - 4050360
Alignment:
| Q |
33 |
tcctctcgcagctataccccacgcctcacacaacaggtagcagcatacttcccacaagactttaaactgatggtgatgtcaatttaatcatcaaccatct |
132 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4050636 |
tcctctcgcagctataccccatgcctcacacaacaggtagcagcacacttcccagaagactttaaactgatggtgatgtcaatttaatcatcaaccatct |
4050537 |
T |
|
| Q |
133 |
tactatttgcccttccctccaactacatttgttgtctcacaatttttcatcttttacctcttttaccacaatttttaatcataacctcttcaactccaaa |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
4050536 |
tactatttgcccttccctccaactacatttgttgtctcacaatttttcctcttttacctcttttaccacaagtttttatcataacttcttcaactccaaa |
4050437 |
T |
|
| Q |
233 |
gtgtgcttacgcgtcctcttaaagattcccttgctctcacataaatcataacacccaaggacttcttagttgtacaac |
310 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4050436 |
gtgtgcttatgcgt-ctcttaaagattcccttgctctcacataaatcataacacccaaggacttcatagttgtacaac |
4050360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 929 times since January 2019
Visitors: 1288