View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063-2-Insertion-11 (Length: 158)
Name: NF0063-2-Insertion-11
Description: NF0063-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063-2-Insertion-11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 5 - 154
Target Start/End: Complemental strand, 51363937 - 51363788
Alignment:
| Q |
5 |
acaattcaattgcatgagtcgaaagttgaaaaccttatcaaattgtgattacaagccataaactaccattgatcaccttttattaccagatatcactcat |
104 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||| |
|
|
| T |
51363937 |
acaattcaatttcatgagtcgaaagttgaaaaccttatcaaattgtgattacaagccataaactaccattgaccaccttctattacaagatatcactcat |
51363838 |
T |
 |
| Q |
105 |
tactcatttgttttccaaaagtaaatgacattgaaagtttactgtagtct |
154 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
51363837 |
tactcatttgttttccaagagtaaatgacattgaaagttttctgtagtct |
51363788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 6e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 6e-26
Query Start/End: Original strand, 41 - 116
Target Start/End: Complemental strand, 17146799 - 17146724
Alignment:
| Q |
41 |
atcaaattgtgattacaagccataaactaccattgatcaccttttattaccagatatcactcattactcatttgtt |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
17146799 |
atcaaattgtcattacaagccataaactaccattgaccaccttttattacaagatatcactcattactcgtttgtt |
17146724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University