View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063-2-Insertion-13 (Length: 98)
Name: NF0063-2-Insertion-13
Description: NF0063-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0063-2-Insertion-13 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 7 - 98
Target Start/End: Complemental strand, 10071431 - 10071337
Alignment:
Q |
7 |
agatgggatgttggttgtagttcaggcaaaact---attcctatgaagacatgttgagttcggtatcatcatgaatattaaaggtgataatgtta |
98 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
10071431 |
agatgggatgttggttgtagttcaggcaaaacttctattcctatgaagacatgttgagttcagtatcatcatgaatattaaaggtgataatgtta |
10071337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University