View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0063-2-Insertion-2 (Length: 882)

Name: NF0063-2-Insertion-2
Description: NF0063-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0063-2-Insertion-2
NF0063-2-Insertion-2
[»] chr2 (1 HSPs)
chr2 (137-181)||(9550938-9550982)
[»] chr8 (1 HSPs)
chr8 (136-168)||(2184560-2184592)


Alignment Details
Target: chr2 (Bit Score: 45; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 137 - 181
Target Start/End: Original strand, 9550938 - 9550982
Alignment:
137 attcgccctatagtgagtcgtattacaattcactggccgtcgttt 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
9550938 attcgccctatagtgagtcgtattacaattcactggccgtcgttt 9550982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 168
Target Start/End: Original strand, 2184560 - 2184592
Alignment:
136 aattcgccctatagtgagtcgtattacaattca 168  Q
    |||||||||||||||||||||||||||||||||    
2184560 aattcgccctatagtgagtcgtattacaattca 2184592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University