View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063-2-Insertion-2 (Length: 882)
Name: NF0063-2-Insertion-2
Description: NF0063-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063-2-Insertion-2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 45; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 137 - 181
Target Start/End: Original strand, 9550938 - 9550982
Alignment:
| Q |
137 |
attcgccctatagtgagtcgtattacaattcactggccgtcgttt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9550938 |
attcgccctatagtgagtcgtattacaattcactggccgtcgttt |
9550982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 168
Target Start/End: Original strand, 2184560 - 2184592
Alignment:
| Q |
136 |
aattcgccctatagtgagtcgtattacaattca |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2184560 |
aattcgccctatagtgagtcgtattacaattca |
2184592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University