View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_high_20 (Length: 207)
Name: NF0063_1D_high_20
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_1D_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 3 - 199
Target Start/End: Complemental strand, 10567053 - 10566857
Alignment:
| Q |
3 |
caatgagatggacatcaactcggaggttccatgtatggggactgattatttagagttcatgaagacgattagatctattccagaccgtggtgagtttgaa |
102 |
Q |
| |
|
|||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10567053 |
caatgagaaggaaaacaactcggaggttccatgtatggggactgattatttagagttcatgaagacgattagatctattccagaccgtggtgagtttgaa |
10566954 |
T |
 |
| Q |
103 |
agtcaatatagtgctatctctgagttatatagttgttctggaccctcagtaacatcctcttggcaaaaggaccaaagtaaatttgtagtgatgtcca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566953 |
agtcaatatagtgctatctctgagttatatagttgttctggaccctcagtaacatcctcttggcaaaaggaccaaagtaaatttgtagtgatgtcca |
10566857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University