View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_12 (Length: 258)
Name: NF0063_1D_low_12
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_1D_low_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 258
Target Start/End: Original strand, 40477869 - 40478121
Alignment:
| Q |
11 |
atcaatctttatttctattggttgctatattatatattgagtattggaactgcaatgttacctattgattggtgaaactgtg--------ttattattga |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40477869 |
atcaatctttatttctattggtt---atattatatattgagtattggaactgcaatgttacctattgattggtgaaactgtgttattgtgttattattga |
40477965 |
T |
 |
| Q |
103 |
tatctcactgtcttttcatttcctatatgaaaaacaggttgcaaaagaatcttctggcaatcaacaaagagcagttggtgaaagtaatgttcaaattaat |
202 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40477966 |
tatctcactgttttttcatttcctatatgaaaaacaggttgcaaaagaatcttctggcaatcaacaaagagcagttggtgaaagtaatgttcaagttaat |
40478065 |
T |
 |
| Q |
203 |
tgttctgactcggatcaaggtggattgaccgaacttgagaaactattgaagcagaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40478066 |
tgttctgactcggatcaaggtggattgaccgaacttgagaaactattgaagcagaa |
40478121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University