View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_14 (Length: 247)
Name: NF0063_1D_low_14
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0063_1D_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 33791189 - 33790957
Alignment:
Q |
13 |
agatggacatcattaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgcta |
112 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
33791189 |
agatgtacatcattaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaacagaatctcttgttgcta |
33791090 |
T |
 |
Q |
113 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgc |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33791089 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgc |
33790990 |
T |
 |
Q |
213 |
tcttgctgctttctctgattcattgcccttctt |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
33790989 |
tcttgctgctttctctgattcattgcccttctt |
33790957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 39 - 153
Target Start/End: Original strand, 33764098 - 33764212
Alignment:
Q |
39 |
taatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgctaatgatattatgtctgcacatgaaact |
138 |
Q |
|
|
|||||| ||||||||||||||||||| |||||| ||||||| || | |||| | || | ||||||||| || | || || ||||||||||||||||| |
|
|
T |
33764098 |
taatccgtcacgtcttcctgtaggaatattgtattttggtcctccagataaggccacagcatctcttgtagcaagtgctacgatgtctgcacatgaaacc |
33764197 |
T |
 |
Q |
139 |
gttgatggacatgca |
153 |
Q |
|
|
||||||||||||||| |
|
|
T |
33764198 |
gttgatggacatgca |
33764212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University