View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_16 (Length: 239)
Name: NF0063_1D_low_16
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_1D_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 28250309 - 28250104
Alignment:
| Q |
18 |
gacatcagatcaaaacaacgaagccttctacagttaattatcaatctcttcccttcagagaaagcagcttttccaatcaacttcctttgctgcctcctcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250309 |
gacatcagatcaaaacaacgaagccttctagagttaattatcaatctcttcccttcggagaaagcagcttttccaatcaacttcctttgctgcctcctcc |
28250210 |
T |
|
| Q |
118 |
gttgcgccatccacctccgcgcctccaccgtctgcaaaaccgaactcgagaaacgaatctcggcaatcctcgaacacgttaccgtcgacgacctcctcgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250209 |
gttgcgccatccacctccgcgcctccaccgtctgcaaaaccgaactcgagaaacgaatctcggcaatcctcgaacacgttaccgtcgacgacctcctcgt |
28250110 |
T |
|
| Q |
218 |
gatgtc |
223 |
Q |
| |
|
|||||| |
|
|
| T |
28250109 |
gatgtc |
28250104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 62 - 175
Target Start/End: Complemental strand, 32179846 - 32179733
Alignment:
| Q |
62 |
tctcttcccttcagagaaagcagcttttccaatcaacttcctttgctgcctcctccgttgcgccatccacctccgcgcctccaccgtctgcaaaaccgaa |
161 |
Q |
| |
|
|||||| || || |||||||| |||||||| ||||||||||| ||||| || |||||||| || ||| |||| |||||||| | || ||||| |||| |
|
|
| T |
32179846 |
tctctttccgtcggagaaagctgcttttccgatcaacttcctctgctgtcttctccgttgtgctatctacctacgcgcctcaagcgcgtgcaagcgcgaa |
32179747 |
T |
|
| Q |
162 |
ctcgagaaacgaat |
175 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
32179746 |
ctcgagaagcgaat |
32179733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1575 times since January 2019
Visitors: 1302