View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_18 (Length: 239)
Name: NF0063_1D_low_18
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_1D_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 5 - 218
Target Start/End: Complemental strand, 36514301 - 36514086
Alignment:
| Q |
5 |
gtccgatgaaagtatacccgatttcgatgatgatcaacaagatttccaagaaataaaagatcctcgacaggtatatatgcat----atttcaatttcttt |
100 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36514301 |
gtccaatgaaagtatacccgattccgatgatgatgaacaagattttcaagaaataaaagatcctcgacaggtatatatgcatgcatatttcaatttcttt |
36514202 |
T |
 |
| Q |
101 |
ctaataatctttttaaaaaatcgataatgcttgcgcaggacgctgctgctactgctgatgcagtaaacaaggttttggaagaacttattcagtcacctgc |
200 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36514201 |
ctaataatctgtttaaaa--tcgataatgctggcgcaggacgctgctgctactgctcatgcagtaaacaaggttttggaagaacttattcagtcaactgc |
36514104 |
T |
 |
| Q |
201 |
atcaaagaagatttgtga |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36514103 |
atcaaagaagatttgtga |
36514086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 117 - 217
Target Start/End: Original strand, 4233725 - 4233825
Alignment:
| Q |
117 |
aaaatcgataatgcttgcgcaggacgctgctgctactgctgatgcagtaaacaaggttttggaagaacttattcagtcacctgcatcaaagaagatttgt |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
4233725 |
aaaatcgataatgcaggcgcaggacgctgctgctactgctgatgcagtaaacaaggttttggaagaatttattcagtcatctgcatcaaagaagatttgt |
4233824 |
T |
 |
| Q |
217 |
g |
217 |
Q |
| |
|
| |
|
|
| T |
4233825 |
g |
4233825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 5 - 96
Target Start/End: Original strand, 4233587 - 4233678
Alignment:
| Q |
5 |
gtccgatgaaagtatacccgatttcgatgatgatcaacaagatttccaagaaataaaagatcctcgacaggtatatatgcatatttcaattt |
96 |
Q |
| |
|
||||| ||||| |||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4233587 |
gtccggtgaaattatacccgataccgatgatgatgaacaagattttgaagaaataaaagatcctcgacaggtatatatgcatatttgaattt |
4233678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 220
Target Start/End: Original strand, 6113532 - 6113585
Alignment:
| Q |
167 |
acaaggttttggaagaacttattcagtcacctgcatcaaagaagatttgtgatg |
220 |
Q |
| |
|
|||| ||||| |||||| | ||||||| |||||||||||||||||||||||||| |
|
|
| T |
6113532 |
acaatgtttttgaagaaatgattcagttacctgcatcaaagaagatttgtgatg |
6113585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University