View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_2 (Length: 390)
Name: NF0063_1D_low_2
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0063_1D_low_2 |
 |  |
|
[»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 231924 - 231619
Alignment:
Q |
1 |
ttgagtttcttcatactcgcgaatgtttgcaaccccaaatgacttgctgaagtctttgtacatctcatcagtgatttcatttatactcttctcaagctcg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
T |
231924 |
ttgagtttcttcatactcgcgaatgtttgcaaccccaactgacttgctgaagtctttgtatatctcatcggtgatttcatttatactcttctcaagctcg |
231825 |
T |
 |
Q |
101 |
cgtatttctgcatttctcttttcaacagcatctcttaacttgatcagttctggactaactcgttcaatttgttttttgatagtccccttttcatcgctca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
231824 |
cgtatttctgcatttctcttttcaacagcagctcttaacttgatcagttctggactaactcgttcaatttgttttttgatagtccccttttcatcgctca |
231725 |
T |
 |
Q |
201 |
atgttggaagcttcttttcaatgcattgcttttcaatctcagcatattgaactttcttcttcagttcgctaattttttcctctacttcagacactttaat |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
231724 |
atgttggaagcttcttttcaatgcattgcttttcaatctcagcatattgagctttcttcttgagttcgctaattttttcctctacttcagacactttaat |
231625 |
T |
 |
Q |
301 |
atgatg |
306 |
Q |
|
|
|||||| |
|
|
T |
231624 |
atgatg |
231619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 6 - 140
Target Start/End: Complemental strand, 30590961 - 30590827
Alignment:
Q |
6 |
tttcttcatactcgcgaatgtttgcaaccccaaatgacttgctgaagtctttgtacatctcatcagtgatttcatttatactcttctcaagctcgcgtat |
105 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||| ||| |||||||||||||||||| ||||||||||| ||| |
|
|
T |
30590961 |
tttcttcatactcgcgaatgtttgcaaccccaactgacttgctgaattctttgtagatccgatcagtgatttcatttatcctcttctcaagagtatgtaa |
30590862 |
T |
 |
Q |
106 |
ttctgcatttctcttttcaacagcatctcttaact |
140 |
Q |
|
|
|||| ||| ||||||||||||||||||||||||| |
|
|
T |
30590861 |
ttctttattcctcttttcaacagcatctcttaact |
30590827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 25840236 - 25840097
Alignment:
Q |
1 |
ttgagtttcttcatactcgcgaatgtttgcaaccccaaatgacttgctgaagtctttgtacatctcatcagtgatttcatttatactcttctcaagctcg |
100 |
Q |
|
|
|||| ||||||||||||| |||| |||| ||| ||||| |||||||||||| | |||||| ||| ||| |||||||||||||| ||||||||||| |
|
|
T |
25840236 |
ttgattttcttcatactcacgaaggtttacaatcccaactgacttgctgaattttttgtaaatccaatcggtgatttcatttatcctcttctcaagagta |
25840137 |
T |
 |
Q |
101 |
cgtatttctgcatttctcttttcaacagcatctcttaact |
140 |
Q |
|
|
||| |||| ||| |||||||||||| |||||||||||| |
|
|
T |
25840136 |
tgtaattctttattcctcttttcaacaacatctcttaact |
25840097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University