View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_20 (Length: 238)
Name: NF0063_1D_low_20
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_1D_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 38990613 - 38990651
Alignment:
| Q |
1 |
agagaatcgaacatgagatcttgagagaagcacagttca |
39 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
38990613 |
agagaatcgaacatgagatcttgagagaaacacacttca |
38990651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1738 times since January 2019
Visitors: 1304