View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_21 (Length: 235)
Name: NF0063_1D_low_21
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_1D_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 12 - 233
Target Start/End: Complemental strand, 17261556 - 17261340
Alignment:
| Q |
12 |
gatggacatcacaacgacgcactgagacgacgatgttgttagcctgtattttcagtcggtaataaatgcggtcgatatggtgtagcaatatcttttattg |
111 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17261556 |
gatgaacatcacaacgacgcaccgagacgacgatgttgt-aggctgtattttcaacaggtaataaatgcggtcgatatggtgtagcaatatcttttattg |
17261458 |
T |
 |
| Q |
112 |
tttgaattggtatgggttataataaccacatctttcacgatcttatatgtgccaaatatctaagagctagcaatagtaacattaattgtaatataaagcc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17261457 |
tttgaattggtatgggttataataaccacatctttcacgatcttatatgtgccaaatatctaagagctagcaatagtaac----attgtaatataaagcc |
17261362 |
T |
 |
| Q |
212 |
tattatgcaaactaagatgcat |
233 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
17261361 |
tatgatgcaaactaagatgcat |
17261340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University