View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_24 (Length: 229)
Name: NF0063_1D_low_24
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_1D_low_24 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 27539822 - 27539594
Alignment:
| Q |
1 |
tccaaaggaacctcatgttgtagtaatgatgcaaaccagatcgcaaagctccatctccaaacggactgtccctgatttcaagcttctgcaaattagggca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27539822 |
tccaaaggaacctcatgttgtagtaatgatgcaaaccagatcgcaaagctccatctccaaacggactgtccctgatttcaagcttctgcaaattagggca |
27539723 |
T |
|
| Q |
101 |
cccttcaagtacatacttaaggctgttgtccgtgtctccggcaaaggcaaccgacaatgtcctgattaattttccataccttccaatgtattcaaaacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27539722 |
cccttcaagtacatacttaaggctgttgtccgtgtctccggcaaaggcaaccgacaatgtcctgattaattttccataccttccaatgtattcaaaacat |
27539623 |
T |
|
| Q |
201 |
cgatcagtcagcaagccagatacagcgag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27539622 |
cgatcagtcagcaagccagatacagcgag |
27539594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 9 - 95
Target Start/End: Complemental strand, 46409307 - 46409221
Alignment:
| Q |
9 |
aacctcatgttgtagtaatgatgcaaaccagatcgcaaagctccatctccaaacggactgtccctgatttcaagcttctgcaaatta |
95 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||| ||||| ||||| ||||||||||||||||| |||| |||| |
|
|
| T |
46409307 |
aacctcatgttgtaaaaatgatgcaaaccagaacgcaaagctccatccccaaatggactatccctgatttcaagcttttgcagatta |
46409221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1422 times since January 2019
Visitors: 1299