View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_27 (Length: 223)
Name: NF0063_1D_low_27
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_1D_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 44 - 213
Target Start/End: Complemental strand, 434316 - 434147
Alignment:
| Q |
44 |
ttccctcaggtagctttaatctcctggcaaaattggaattttcttccacttgacccaagatgacagatttatgattaagacagtgaaaaaattcgaagtc |
143 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
434316 |
ttccctcagggagctttaatctcctggcaaaagtggaattttcttccacttgacccaagatgacagatttatgattaagacagtcaaaaaatccgaagtc |
434217 |
T |
|
| Q |
144 |
aaggtttgtttttggttgttaaattgaaaacatttttccgtgttcgttcaaactggtatgatgtccatct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
434216 |
aaggtttgtttttggttgttaaattgaaaacatttttccgtgttcgttcaaactggtataatgtacatct |
434147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 46 - 213
Target Start/End: Original strand, 32938459 - 32938626
Alignment:
| Q |
46 |
ccctcaggtagctttaatctcctggcaaaattggaattttcttccacttgacccaagatgacagatttatgattaagacagtgaaaaaattcgaagtcaa |
145 |
Q |
| |
|
|||||||| |||||| |||||||||||||| ||||| |||||| |||||||||||||||| ||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
32938459 |
ccctcagggagctttcatctcctggcaaaagtggaagcttcttctacttgacccaagatgatagatttatgataaagacggtgaaaaaatccgaagtcaa |
32938558 |
T |
|
| Q |
146 |
ggtttgtttttggttgttaaattgaaaacatttttccgtgttcgttcaaactggtatgatgtccatct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||| || ||||| |
|
|
| T |
32938559 |
ggtttgtttttggttgttaaattgaaaacatttttccatgtttgttcaaactagtatgacgtacatct |
32938626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 47
Target Start/End: Complemental strand, 434380 - 434350
Alignment:
| Q |
17 |
aagttcttttacaattgaggaagccatttcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
434380 |
aagttcttttacaattgaggaagccatttcc |
434350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 91 - 149
Target Start/End: Original strand, 24524401 - 24524459
Alignment:
| Q |
91 |
acttgacccaagatgacagatttatgattaagacagtgaaaaaattcgaagtcaaggtt |
149 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||| |
|
|
| T |
24524401 |
acttgacccaagatgacagattcatgattaagacagtgaagaaatctgaagtcaaggtt |
24524459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1595 times since January 2019
Visitors: 1303