View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_3 (Length: 353)
Name: NF0063_1D_low_3
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0063_1D_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 9 - 340
Target Start/End: Original strand, 2819388 - 2819719
Alignment:
Q |
9 |
gatggacatcaagcaacattctatatacacaataaatgtccctttccaatatggccagcaacagcaccaaacactggtcaaccaattatagcagatggtg |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2819388 |
gatggacatcaagcaacattctatatacacaataaatgtccctttccaatatggcctgcaacagcaccaaacactggtcaaccaattatagcagatggtg |
2819487 |
T |
 |
Q |
109 |
gattctaccttccttcaggccaaacaaagaaaattctagcaccatggtcatggagtggtagaatttgggctagaacaggttgcaattttgcttcaaataa |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2819488 |
gattctaccttccttcaggccaaacaaagaaaattctagcaccatggtcatggagtggtagaatttgggctagaacaggttgcaattttgcttcaaataa |
2819587 |
T |
 |
Q |
209 |
ttggaaaccatcttgtgaaactggggattgtgatggaagattagcttgcaatggactcattggaacacctccagctacattagttgagatcacacttcaa |
308 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
2819588 |
ttggaaaccatcttgtgaaactggggattgtgatggaagattagcttgcaatggactcattggaacacctccagctacattagttgaaatcacacttcaa |
2819687 |
T |
 |
Q |
309 |
ggtgataaagggaaaccaaatttctatgatgt |
340 |
Q |
|
|
||||||||||||| |||||||||||||||||| |
|
|
T |
2819688 |
ggtgataaagggagaccaaatttctatgatgt |
2819719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University