View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0063_1D_low_32 (Length: 205)

Name: NF0063_1D_low_32
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0063_1D_low_32
NF0063_1D_low_32
[»] chr5 (1 HSPs)
chr5 (1-126)||(14321323-14321448)
[»] chr4 (1 HSPs)
chr4 (1-77)||(41907708-41907784)


Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 14321323 - 14321448
Alignment:
1 gatacaacaccgcatcacgacccttgacaaacctttaagtcgactacatctaagaggacaaccgaagaaggttgggaagtagccgatgcttttaccaccg 100  Q
    |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
14321323 gatacaacaccgcatcgcgacccttgacaaacctttaagtcgacgacatctaagaggacaaccgaagaaggttgggaagtagccgatgcttgtaccaccg 14321422  T
101 gtagaaaggcgacacacgatgtccat 126  Q
    ||||||||||||||||| ||||||||    
14321423 gtagaaaggcgacacacaatgtccat 14321448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 41907784 - 41907708
Alignment:
1 gatacaacaccgcatcacgacccttgacaaacctttaagtcgactacatctaagaggacaaccgaagaaggttggga 77  Q
    |||||||||||  ||||| |||||||  |||||||| |||| ||  |||| ||||||||||||| |||| |||||||    
41907784 gatacaacaccatatcacaacccttggaaaacctttcagtcaacggcatcgaagaggacaaccggagaatgttggga 41907708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University