View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_1D_low_35 (Length: 201)
Name: NF0063_1D_low_35
Description: NF0063_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_1D_low_35 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 232499 - 232315
Alignment:
| Q |
17 |
gacatcaacgcatccatgtttttcttgtattctacctctattttatccctgtcacagtgtctcctatttctcagtgtcctactgagctcatcaaagtcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
232499 |
gacatcaacgcatccatgtttttcttgtattctacctctattttatccctgtcacagtgtctcctatttctcagtgtcctactgagctcatcaaagtcaa |
232400 |
T |
 |
| Q |
117 |
aaactggacctgttgagctatcggtatccataggatctgatatgattggaaggttaatctgctccagcttacacttttcttgtat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
232399 |
aaactggacctgttgagctatcggtatccataggatctgatatgattggaaggttaatctgctccagcttacacttttcttgtat |
232315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 30592150 - 30591971
Alignment:
| Q |
20 |
atcaacgcatccatgtttttcttgtattctacctctattttatccctgtcacagtgtctcctatttctcagtgtcctactgagctcatcaaagtcaaaaa |
119 |
Q |
| |
|
||||| |||||||| |||| ||| | |||||||||||||||||||||||| | |||||||||| | | ||||| |||||||||| |||||||||||||| |
|
|
| T |
30592150 |
atcaatgcatccattttttgcttaaagtctacctctattttatccctgtcagattgtctcctatcttttagtgttctactgagcttatcaaagtcaaaaa |
30592051 |
T |
 |
| Q |
120 |
ctggacc---tgttgagctatcggtatccataggatctgatatgattggaaggttaatctgctccagcttacacttttct |
196 |
Q |
| |
|
||||||| |||||| |||| |||||||| ||||||| ||||||||||||| |||| ||||| || | |||||||||| |
|
|
| T |
30592050 |
ctggacccggtgttgaagtatcagtatccatgggatctggtatgattggaaggctaatttgctctagttcacacttttct |
30591971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University