View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_high_20 (Length: 327)
Name: NF0063_2D_high_20
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_2D_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 98 - 308
Target Start/End: Complemental strand, 33611735 - 33611526
Alignment:
| Q |
98 |
gtaagattgttgattcaactcacactgatgtggatatctcattgatggatgatcttatgtaaacaacaaacctcaactcacctaattt-gttttttctat |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||| || | |||||||||||||||||||||||||||||||| || |||| |||||||||||| ||||||| ||| |
|
|
| T |
33611735 |
gtaagatcgttgattcaactcacactgatttgaacatctcattgatggatgatcttatgtaaacaactaagctcagctcacctaattttgttttttgtat |
33611636 |
T |
 |
| Q |
197 |
caaaagaaattagagaaaggaggaatgatatttatggacaagtgagttgcagcccccacctggatttcaatgtcaactagccagcttttggggccatctt |
296 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
33611635 |
caaaagaaattagagaa-ggaggaatgatatttatggacaagtgagttgcagcccccacctggatttcaatgtcaaatagccagc-tttggggccatctt |
33611538 |
T |
 |
| Q |
297 |
caagtagcttca |
308 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33611537 |
caagtagcttca |
33611526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 3 - 89
Target Start/End: Complemental strand, 33612433 - 33612347
Alignment:
| Q |
3 |
ttcgtacaccataacattcgtaggtcagcctaactgtcaatcgactatctagtggatcaatcatgaaattcacaaacgtctaatttt |
89 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| || |||| ||||||||||| ||||||||||| |||||||||| ||| |||| |
|
|
| T |
33612433 |
ttcgtacaccataacattcgtaggtcggcctaactatcgatcgtctatctagtgggtcaatcatgaatttcacaaacgcctattttt |
33612347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University