View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_high_35 (Length: 237)
Name: NF0063_2D_high_35
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_2D_high_35 |
 |  |
|
| [»] scaffold0790 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 2299366 - 2299568
Alignment:
| Q |
16 |
tggtatacttcttgcatttttgtttttaggttgttcatctagcctttgtcgtgcttcactttttctttggagtaatctggtttagttccgctcagctgta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2299366 |
tggtatacttcttgcatttttgtttttaggttgttcatctggcctttgtcgcgcttcactttttctttggagtaatctggtttagttccgctcagctgta |
2299465 |
T |
 |
| Q |
116 |
gcaggctttcatgcaactttgcctctgttgtgcggtgtttcaatcgtctgctgcatcagtttgnnnnnnnccgagtgccttggttttagtgtcatggctg |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2299466 |
gcaggctttcatgcaactttgcttctgttgtgcggtgtttctatcgtctgctgcatcagtttgttttttt-cgagtgccttggttttagtgtcatggctg |
2299564 |
T |
 |
| Q |
216 |
attt |
219 |
Q |
| |
|
|||| |
|
|
| T |
2299565 |
attt |
2299568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0790 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 75 - 171
Target Start/End: Original strand, 3449 - 3545
Alignment:
| Q |
75 |
tttttctttggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcctctgttgtgcggtgtttcaatcgtctgctgcat |
171 |
Q |
| |
|
|||| |||||||||||| |||||| |||| |||||||||||| ||||||||||||| ||||| |||||| ||| ||||||| |||||||||||||| |
|
|
| T |
3449 |
ttttgctttggagtaatatggttttgttcagctcagctgtagtaggctttcatgcagttttgcttctgttctgcagtgtttcgatcgtctgctgcat |
3545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 75 - 171
Target Start/End: Original strand, 38684349 - 38684445
Alignment:
| Q |
75 |
tttttctttggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcctctgttgtgcggtgtttcaatcgtctgctgcat |
171 |
Q |
| |
|
|||| |||||||||||| |||||| |||| |||||||| ||| || |||||||||| ||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
38684349 |
ttttgctttggagtaatatggttttgttcagctcagctatagtagactttcatgcagttttgcttctgttgtgtagtgtttctatcgtctgctgcat |
38684445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University