View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0063_2D_high_37 (Length: 228)

Name: NF0063_2D_high_37
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0063_2D_high_37
NF0063_2D_high_37
[»] chr6 (4 HSPs)
chr6 (107-210)||(13855055-13855158)
chr6 (1-113)||(13855191-13855303)
chr6 (107-208)||(13849267-13849368)
chr6 (1-110)||(13849401-13849510)


Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 107 - 210
Target Start/End: Complemental strand, 13855158 - 13855055
Alignment:
107 tggcggtgggagggaagttgttgagttttgcgaaggtggttgctttggagagagtgcggctgccgacggcggagattgtggcggtggaagagaggagaat 206  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13855158 tggcggtgggacggaagttgttgagttttgcgaaggtggttgctttggagagagtgcggctgccgacggcggagattgtggcggtggaagagaggagaat 13855059  T
207 ggtg 210  Q
    ||||    
13855058 ggtg 13855055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 13855191 - 13855303
Alignment:
1 gaccctaatgttgacgctgtttacttgccattactgacgacgttgcatgtgaaatgggcggtggctgctgcaaagaaggggaagcatgtgttgcttgaga 100  Q
    ||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
13855191 gaccctaatgttgacgctgtttacttgccgttaccgacgacgttacatgtgaaatgggcggtggctgctgcgaagaaggggaagcatgtgttgcttgaga 13855290  T
101 aaccggtggcggt 113  Q
    |||||||||||||    
13855291 aaccggtggcggt 13855303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 107 - 208
Target Start/End: Complemental strand, 13849368 - 13849267
Alignment:
107 tggcggtgggagggaagttgttgagttttgcgaaggtggttgctttggagagagtgcggctgccgacggcggagattgtggcggtggaagagaggagaat 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||    
13849368 tggcggtgggagggaagttgttgagttttgcgaaggtggttgctttggagagagtgcggctgccgacggcagagatggtggcggtggaagagaggagaat 13849269  T
207 gg 208  Q
    ||    
13849268 gg 13849267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 13849401 - 13849510
Alignment:
1 gaccctaatgttgacgctgtttacttgccattactgacgacgttgcatgtgaaatgggcggtggctgctgcaaagaaggggaagcatgtgttgcttgaga 100  Q
    |||||||||||||||||||||||| |||| || | ||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||| | ||||    
13849401 gaccctaatgttgacgctgtttacgtgccgttgccgactacgttgcatgtgaaatgggcggtggctgctgcgaagaaggggaagcatgttttgttagaga 13849500  T
101 aaccggtggc 110  Q
    | ||||||||    
13849501 agccggtggc 13849510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University