View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0063_2D_high_38 (Length: 225)

Name: NF0063_2D_high_38
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0063_2D_high_38
NF0063_2D_high_38
[»] chr8 (1 HSPs)
chr8 (18-177)||(30635591-30635750)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 30635750 - 30635591
Alignment:
18 catactagactcaggagaatattaatttcaaaatcaaactagttgcagtcgaacacatgcattatgcatgacacattttttatttaaaaatgcaatgaat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
30635750 catactagactcaggagaatattaatttcaaaatcaaactagttgcagtcgaacacatgcattatgcatgacacattttttatttaaaaatacaatgaat 30635651  T
118 cagaggctagaatataaaaatcttatattatttactttagtcaacaattcccttgctctc 177  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
30635650 cagaggctagaatatagaaatcttatattatttactttagtcaacaattcccttgctctc 30635591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University