View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_high_39 (Length: 208)
Name: NF0063_2D_high_39
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_2D_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 9 - 189
Target Start/End: Original strand, 2813751 - 2813931
Alignment:
| Q |
9 |
tggtgttctctgaggagttcttaaagaagtcatggcttgggtgggtgtctgtggataattagggagaagagcacgagtagcaatgctgcctttggtgagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2813751 |
tggtgttctctgaggagttcttaaaggagtcatggcttggttgggtgtctgtggataattagggagaagagcacgagtagcactgctgcctttggtgagt |
2813850 |
T |
 |
| Q |
109 |
tcatcgctgcccacaaggtcactggcataaccaaacttggcaatttcatccaattcttgatcggaaatctgaggtggtgga |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813851 |
tcatcgctgcccacaaggtcactggcataaccaaacttggcaatttcatccaattcttgatcggaaatctgaggtggtgga |
2813931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 9 - 189
Target Start/End: Complemental strand, 47753063 - 47752883
Alignment:
| Q |
9 |
tggtgttctctgaggagttcttaaagaagtcatggcttgggtgggtgtctgtggataattagggagaagagcacgagtagcaatgctgcctttggtgagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||| |||||| |||| |||| ||||||| |
|
|
| T |
47753063 |
tggtgttctctgaggagttcttaaaggagtcttggcttggttgggtgtctgtggataattagggagaagagcacgggtagcactgctaccttcggtgagt |
47752964 |
T |
 |
| Q |
109 |
tcatcgctgcccacaaggtcactggcataaccaaacttggcaatttcatccaattcttgatcggaaatctgaggtggtgga |
189 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47752963 |
tcctcgctgcccacaaggtcactggcataacccaacttggcaatttcatccaattcttgatcggaaatctgaggcggtgga |
47752883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University