View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_low_52 (Length: 287)
Name: NF0063_2D_low_52
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_2D_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 1792953 - 1792685
Alignment:
| Q |
1 |
tcagatgcattgtttgtggatggatcgaaatcggaggatgtaggtttcatgcagnnnnnnnnaatctagaaaaaccaaatataaaatttgcgtgaatgca |
100 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792953 |
tcagatgcattgtttgtcgatggatcaaaatcggaggatgtaggtttcatgcagttttttttaatctagaaaaaccaaatataaaatttgcgtgaatgca |
1792854 |
T |
 |
| Q |
101 |
ggaaatctgcatgaattggaatccctattaaagggcagtatatggtaggtaacattctgagtaaatagcaaagaaagaatgtctcattcacacacaagct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792853 |
ggaaatctgcatgaattggaatccctattaaagcgcagtatatggtaggtaacattctgagtaaatagcaaagaaagaatgtctcattcacacacaagct |
1792754 |
T |
 |
| Q |
201 |
taggtatgcgtgcatttgaagaataagaatgtgggttttcatggagaatagagaatcaagggggtgaag |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792753 |
taggtatgcgtgcatttgaagaataagaatgtgggttttcatggagaatagagaatcaagggggtgaag |
1792685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University