View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_low_67 (Length: 260)
Name: NF0063_2D_low_67
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0063_2D_low_67 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 126 - 255
Target Start/End: Complemental strand, 2113115 - 2112986
Alignment:
Q |
126 |
tatattaaccttgacaaacatcatgtgacataattaggggaatgttgaatcaataattaagtatgtggtcatgagtttaatcttcgctcaatggagacgt |
225 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2113115 |
tatattaaccttgacaaacatcatgtgacataattagggggatgttgaatcaataattaagtatgtggtcatgagtttaatcttcgctcaatggagacgt |
2113016 |
T |
 |
Q |
226 |
atggaaaagagtatgttaaaatcatgatca |
255 |
Q |
|
|
|||||||||| ||||||||||||||||||| |
|
|
T |
2113015 |
atggaaaagaatatgttaaaatcatgatca |
2112986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University