View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_low_70 (Length: 259)
Name: NF0063_2D_low_70
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0063_2D_low_70 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 15344003 - 15344276
Alignment:
Q |
1 |
ggaaattctgcgcttttgcacaactcttttgaactgttgtcatctgattctgaggccaatcatggggaggctgatatgaccatttatgcttccactgcag |
100 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15344003 |
ggaaattctgcgcttttgcaaaacttttttgaactgttgtcatctgattctgaggccaatcatggggaggctgatatgaccatttatgcttccactgcag |
15344102 |
T |
 |
Q |
101 |
agcagttggttgatacccggatggaaagtttggatgctcctttagagttagcttctaaccagatgggaatattggatgttccttt-aatattggatgttc |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | || |||| |
|
|
T |
15344103 |
agcagttggttgatacccggatggaaagtttggatgctcctttagagttagcttctaaccagatgggaatattggatgttcctttaaagactgcctgttt |
15344202 |
T |
 |
Q |
200 |
ct--------------tttaaggcaccctgttcttcggaaaccaggcccttaaacaatagtgttacttctgtgt |
259 |
Q |
|
|
| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15344203 |
gttgactgacacatgttttaaggcaccttgttcttcggaaaccaggcccttaaacaatagtgttacttctgtgt |
15344276 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University