View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_low_83 (Length: 228)
Name: NF0063_2D_low_83
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0063_2D_low_83 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 107 - 210
Target Start/End: Complemental strand, 13855158 - 13855055
Alignment:
Q |
107 |
tggcggtgggagggaagttgttgagttttgcgaaggtggttgctttggagagagtgcggctgccgacggcggagattgtggcggtggaagagaggagaat |
206 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13855158 |
tggcggtgggacggaagttgttgagttttgcgaaggtggttgctttggagagagtgcggctgccgacggcggagattgtggcggtggaagagaggagaat |
13855059 |
T |
 |
Q |
207 |
ggtg |
210 |
Q |
|
|
|||| |
|
|
T |
13855058 |
ggtg |
13855055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 13855191 - 13855303
Alignment:
Q |
1 |
gaccctaatgttgacgctgtttacttgccattactgacgacgttgcatgtgaaatgggcggtggctgctgcaaagaaggggaagcatgtgttgcttgaga |
100 |
Q |
|
|
||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
13855191 |
gaccctaatgttgacgctgtttacttgccgttaccgacgacgttacatgtgaaatgggcggtggctgctgcgaagaaggggaagcatgtgttgcttgaga |
13855290 |
T |
 |
Q |
101 |
aaccggtggcggt |
113 |
Q |
|
|
||||||||||||| |
|
|
T |
13855291 |
aaccggtggcggt |
13855303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 107 - 208
Target Start/End: Complemental strand, 13849368 - 13849267
Alignment:
Q |
107 |
tggcggtgggagggaagttgttgagttttgcgaaggtggttgctttggagagagtgcggctgccgacggcggagattgtggcggtggaagagaggagaat |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
T |
13849368 |
tggcggtgggagggaagttgttgagttttgcgaaggtggttgctttggagagagtgcggctgccgacggcagagatggtggcggtggaagagaggagaat |
13849269 |
T |
 |
Q |
207 |
gg |
208 |
Q |
|
|
|| |
|
|
T |
13849268 |
gg |
13849267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 13849401 - 13849510
Alignment:
Q |
1 |
gaccctaatgttgacgctgtttacttgccattactgacgacgttgcatgtgaaatgggcggtggctgctgcaaagaaggggaagcatgtgttgcttgaga |
100 |
Q |
|
|
|||||||||||||||||||||||| |||| || | ||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||| | |||| |
|
|
T |
13849401 |
gaccctaatgttgacgctgtttacgtgccgttgccgactacgttgcatgtgaaatgggcggtggctgctgcgaagaaggggaagcatgttttgttagaga |
13849500 |
T |
 |
Q |
101 |
aaccggtggc |
110 |
Q |
|
|
| |||||||| |
|
|
T |
13849501 |
agccggtggc |
13849510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University