View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_low_85 (Length: 225)
Name: NF0063_2D_low_85
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0063_2D_low_85 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 30635750 - 30635591
Alignment:
Q |
18 |
catactagactcaggagaatattaatttcaaaatcaaactagttgcagtcgaacacatgcattatgcatgacacattttttatttaaaaatgcaatgaat |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
30635750 |
catactagactcaggagaatattaatttcaaaatcaaactagttgcagtcgaacacatgcattatgcatgacacattttttatttaaaaatacaatgaat |
30635651 |
T |
 |
Q |
118 |
cagaggctagaatataaaaatcttatattatttactttagtcaacaattcccttgctctc |
177 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30635650 |
cagaggctagaatatagaaatcttatattatttactttagtcaacaattcccttgctctc |
30635591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University