View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_low_89 (Length: 205)
Name: NF0063_2D_low_89
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_2D_low_89 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 188
Target Start/End: Complemental strand, 32855859 - 32855684
Alignment:
| Q |
13 |
caacaggtagcacttgatattttcagctggaaaggacctgagtatcagaatgactaatgatgatttgagcatgtagagcagggtaactcttctcttaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32855859 |
caacaggtagcacttgatattttcagctggaaaggacctgagtatcagaatgactaatgatgatttgagcatgtagagcagggtaactcttctcttgatt |
32855760 |
T |
 |
| Q |
113 |
gatgtgagcttttaaactttataatacagtctcaaagcaaatcacaattcaacaccagacacgccccggattccac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32855759 |
gatgtgagcttttaaactttataatacagtctcaaaacaaatcacaattcaacaccagacacgccccggattccac |
32855684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 85 - 169
Target Start/End: Complemental strand, 32850369 - 32850285
Alignment:
| Q |
85 |
gtagagcagggtaactcttctcttaattgatgtgagcttttaaactttataatacagtctcaaagcaaatcacaattcaacacca |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32850369 |
gtagagcagggtaactcttctctcaattgatgtgagcttttaaactttataatacagtctcaaaacaaatcacaattcaacacca |
32850285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 53
Target Start/End: Complemental strand, 32850460 - 32850420
Alignment:
| Q |
13 |
caacaggtagcacttgatattttcagctggaaaggacctga |
53 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
32850460 |
caacaggtagcagttggtattttcagctggaaaggacctga |
32850420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University