View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0063_2D_low_91 (Length: 201)
Name: NF0063_2D_low_91
Description: NF0063_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0063_2D_low_91 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 28 - 183
Target Start/End: Complemental strand, 12885058 - 12884900
Alignment:
| Q |
28 |
ctccctttggtttgtttttgtctctt-taatatttatgatgatttcttagacaatatgacttacttgcctctgatattcatatttcatcaaa--ccagtc |
124 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
12885058 |
ctccctttggtttgtttttgtctcttataatatttatgatgatttcttagacaatatgacttacttgcttctgatattcatatttcatcaaaaaccagtc |
12884959 |
T |
 |
| Q |
125 |
aaaatagttacaagattttcttccttgtaaagaaatgagagtagtgttactacctaaac |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12884958 |
aaaatagttacaagattttcttccttgtaaagaaatgagagtagtgttactacctaaac |
12884900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University