View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0064_low_8 (Length: 266)
Name: NF0064_low_8
Description: NF0064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0064_low_8 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 28 - 266
Target Start/End: Original strand, 39482165 - 39482399
Alignment:
Q |
28 |
gtgcgtccagtacatgtaacatgttggtctcaagttagcagcacaggtttgatctgactaggaagcttgaaacaggaatgaatgtattaacacagtctta |
127 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
39482165 |
gtgcgtccagtacatgtaacatgttggtctcaaattagcagcacaggtttgatctgactaggaagcttgaaacaggaat----gtattaacacagtctta |
39482260 |
T |
 |
Q |
128 |
aaatataataatgtttttatattttcacaataatgattgatgtatagtaaacagaaaggtttattatatatagtaaacataaaggtttctcggacacaaa |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39482261 |
aaatataataatgtttttatattttcacaataatgattgatgtatagtaaacagaaaggtttattatatatagtaaacataaaggtttctcggacacaaa |
39482360 |
T |
 |
Q |
228 |
atctgacatcaacacaccgtatgtatatgcgattaacaa |
266 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
39482361 |
atctgacatcaacacaccgaatgtatatgcgattaacaa |
39482399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 724 times since January 2019
Visitors: 1282