View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0066-INSERTION-5 (Length: 200)
Name: NF0066-INSERTION-5
Description: NF0066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0066-INSERTION-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 43091415 - 43091613
Alignment:
| Q |
1 |
attcaacacttcaacaattcatgacaacataatcttctgtggcaaactcattcccttcaaagatcatcaatatgttcctcataaccnnnnnnnttgtact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
43091415 |
attcaacacttcaacaattcatgacaacataatcttctgtggcaaactcattcccttcaaagatcatcaatatgttcctcataaccaaaaaaattgtgct |
43091514 |
T |
|
| Q |
101 |
aaacccacttcaaattcaaaggccatgaaatctagtaatggttctatagctaacttgaagagtaagagaaatgaagaagaagtaaagggtagtgtgaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091515 |
aaacccacttcaaattcaaaggccatgaaatctagtaatggttctatagctaacttgaagagtaagagaaatgaagaagaagtaaagggtagtgtgaat |
43091613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 713 times since January 2019
Visitors: 1282