View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0066-INSERTION-6 (Length: 252)

Name: NF0066-INSERTION-6
Description: NF0066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0066-INSERTION-6
NF0066-INSERTION-6
[»] chr8 (1 HSPs)
chr8 (82-126)||(10346395-10346439)
[»] chr5 (1 HSPs)
chr5 (86-123)||(40636950-40636987)


Alignment Details
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 82 - 126
Target Start/End: Original strand, 10346395 - 10346439
Alignment:
82 tatgtgtgaatcaaagaagtaaatgtgatttcattagcagatcat 126  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
10346395 tatgtgtgaatcaaagaagtaaatgtgatttcattagcagatcat 10346439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 86 - 123
Target Start/End: Original strand, 40636950 - 40636987
Alignment:
86 tgtgaatcaaagaagtaaatgtgatttcattagcagat 123  Q
    ||||||| ||||||||||||||||||||||||| ||||    
40636950 tgtgaatgaaagaagtaaatgtgatttcattaggagat 40636987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University