View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0066-INSERTION-6 (Length: 252)
Name: NF0066-INSERTION-6
Description: NF0066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0066-INSERTION-6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 82 - 126
Target Start/End: Original strand, 10346395 - 10346439
Alignment:
Q |
82 |
tatgtgtgaatcaaagaagtaaatgtgatttcattagcagatcat |
126 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10346395 |
tatgtgtgaatcaaagaagtaaatgtgatttcattagcagatcat |
10346439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 86 - 123
Target Start/End: Original strand, 40636950 - 40636987
Alignment:
Q |
86 |
tgtgaatcaaagaagtaaatgtgatttcattagcagat |
123 |
Q |
|
|
||||||| ||||||||||||||||||||||||| |||| |
|
|
T |
40636950 |
tgtgaatgaaagaagtaaatgtgatttcattaggagat |
40636987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University