View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0066-INSERTION-7 (Length: 194)
Name: NF0066-INSERTION-7
Description: NF0066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0066-INSERTION-7 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 45285939 - 45285746
Alignment:
Q |
1 |
caaagatccaaaccagcttatgttacagggccacagtcatcattcagccatcatggtctatcccattcatgatttttctcaaacatttaccgtcttcata |
100 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45285939 |
caaagatccagaccagcttatgttacagggccacagtcatcattcagccatcatggtctatcccattcatgatttttctcaaacatttaccgtcttcata |
45285840 |
T |
 |
Q |
101 |
taagatacacatatacattgcagtacaaagtagacaaccggtgttcctattgctagatactatcaaatattgcaacaataccaaaactaattgc |
194 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45285839 |
taatatacacatatacattgcagtacaaagtagacaaccggtgttcctattgctagatactatcaaatattgcaacaataccaaaactaattgc |
45285746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University