View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0066-INSERTION-8 (Length: 124)
Name: NF0066-INSERTION-8
Description: NF0066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0066-INSERTION-8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 43; Significance: 7e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 75 - 117
Target Start/End: Complemental strand, 8296237 - 8296195
Alignment:
| Q |
75 |
gctcttgttgaattgaatgccttcgcaaagcggtttcaaatgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8296237 |
gctcttgttgaattgaatgccttcgcaaagcggtttcaaatgc |
8296195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 13 - 51
Target Start/End: Original strand, 4572674 - 4572712
Alignment:
| Q |
13 |
aattggaacgtcgatgatcgttagattgagatgctgtta |
51 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4572674 |
aattggaacgtcgatgattgttagattgagatgctgtta |
4572712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 13 - 51
Target Start/End: Original strand, 4584768 - 4584806
Alignment:
| Q |
13 |
aattggaacgtcgatgatcgttagattgagatgctgtta |
51 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4584768 |
aattgaaacgtcgatgatcgttagattgagatgctgtta |
4584806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 701 times since January 2019
Visitors: 1282