View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0066_low_12 (Length: 244)
Name: NF0066_low_12
Description: NF0066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0066_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 59 - 229
Target Start/End: Original strand, 40046771 - 40046941
Alignment:
Q |
59 |
tcgggtaagacccgacaactgtcttaatggttgcgatatgatcaaggttgatcttttaatcaatggagaatgctagatttcaggtttgattcttccaatg |
158 |
Q |
|
|
|||| ||||||| |||||||||||||||||||| || |||||||| |||| ||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
40046771 |
tcggataagacctgacaactgtcttaatggttgagacatgatcaaagttggtcttttaattaatggagaatgctagattttaggtttgattcttccaatg |
40046870 |
T |
 |
Q |
159 |
ttaatttaggtatgctagtttaacttcttaaatattttttatcacgactcctctgcatcaatttgatgatg |
229 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40046871 |
ttaatttagatatgctagtttaacttcttaaatattttttatcacgactcctctgcatcaatttgatgatg |
40046941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University