View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0066_low_6 (Length: 424)
Name: NF0066_low_6
Description: NF0066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0066_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 62 - 289
Target Start/End: Complemental strand, 30538866 - 30538626
Alignment:
| Q |
62 |
gttctcaatatatctttccacgttgtagaaatgaaatgcttgtcagttgatttttaaaagaattattttaatgggaaacttatcgag------------- |
148 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30538866 |
gttctcaatatatctttccacattgtagaaatgaaatgcttgtcagttgatttttaaaagaattattttaatgggaaacttatcgagcaagttaactatg |
30538767 |
T |
 |
| Q |
149 |
tgaggtctaggattgatacacatatgttattgattactctctttggttgaaaatatttctttgatctcctctagaatcaataattcatggaggacatgtt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30538766 |
tgaggtctaggattgatacacatatgttattgattactctctttggttgaaaatatttctttgatctcctctagaatcaataattcatggaggacatgtt |
30538667 |
T |
 |
| Q |
249 |
tgtagtgagtcgggattgagaagagctcagagtagtatcaa |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30538666 |
tgtagtgagtcgggattgagaagagctcagagtagtatcaa |
30538626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 290 - 340
Target Start/End: Complemental strand, 30538602 - 30538552
Alignment:
| Q |
290 |
ggtcactcataagtgtgaagtttggatggacgaacgtctgattgatggaag |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30538602 |
ggtcactcataagtgtgaagtttggatggacgaacgtctgattgatggaag |
30538552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University