View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0069_high_16 (Length: 267)
Name: NF0069_high_16
Description: NF0069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0069_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 7 - 206
Target Start/End: Original strand, 20301565 - 20301762
Alignment:
| Q |
7 |
tttcatacggtgtataacaacctctttggtactctatttgcaggatatgcctctcatgtctcttgactatggtttccttgttatgtgagtttctcttttg |
106 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20301565 |
tttcatacagtgtataacaatctctt-ggtactctctttgcaggatatgcctctcatgtctcttgactatggtttccttgttatgcgagtttctcttttg |
20301663 |
T |
|
| Q |
107 |
tctttaataggtaagtttagattatttgattttcttacttatcagtgaagtaacatgttctgaatatcccnnnnnnnatttgtggtattgaaatctataa |
206 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20301664 |
tctttaataggtaaatttggattatttgattttcttacttatgagtgcagtaacatgttctgaatatccc-tattttatttgtggtattgaaatctataa |
20301762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 138
Target Start/End: Original strand, 20299167 - 20299262
Alignment:
| Q |
43 |
tttgcaggatatgcctctcatgtctcttgactatggtttccttgttatgtgagtttctcttttgtctttaataggtaagtttagattatttgattt |
138 |
Q |
| |
|
|||||||| |||||| ||| ||| | || |||||||| |||| ||||||| ||||||||||| |||||| ||||||||||| ||| |||| |||| |
|
|
| T |
20299167 |
tttgcaggctatgccactcctgttttttcactatggtctcctagttatgttagtttctctttggtctttcgtaggtaagttttgatcattttattt |
20299262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 69; Significance: 5e-31; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 32 - 175
Target Start/End: Original strand, 30246372 - 30246518
Alignment:
| Q |
32 |
ttggtactctatttgcaggatatgcctctcatgtctcttgactatggtttccttgttatgtgagtttctcttttgtctttaataggtaagtttagattat |
131 |
Q |
| |
|
|||||| ||| |||| ||||||||||||||||||||||||||| |||||||||||||||| || ||| ||||||| || | |||||||||||| |||||| |
|
|
| T |
30246372 |
ttggtagtctctttgtaggatatgcctctcatgtctcttgactttggtttccttgttatgcgactttatcttttggctatcataggtaagtttggattat |
30246471 |
T |
|
| Q |
132 |
ttgattttctta---cttatcagtgaagtaacatgttctgaatatcc |
175 |
Q |
| |
|
| |||| |||| |||||||||| |||||||||| |||||||||| |
|
|
| T |
30246472 |
cttatttccttacttcttatcagtgcagtaacatgtcctgaatatcc |
30246518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 30481303 - 30481250
Alignment:
| Q |
32 |
ttggtactctatttgcaggatatgcctctcatgtctcttgactatggtttcctt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30481303 |
ttggtactctatttgcaggatatgcctctcatgtctcttgactatggtttcctt |
30481250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 111
Target Start/End: Complemental strand, 30204933 - 30204857
Alignment:
| Q |
35 |
gtactctatttgcaggatatgcctctcatgtctcttgactatggtttccttgttatgtgagtttctcttttgtcttt |
111 |
Q |
| |
|
||||||| |||||| ||| ||| ||| |||||||| || ||||| |||||||||||| ||||||| | |||||||| |
|
|
| T |
30204933 |
gtactctctttgcaagatgagccactcttgtctcttcacaatggtctccttgttatgttagtttctgtgttgtcttt |
30204857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1463 times since January 2019
Visitors: 1299