View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0069_high_17 (Length: 257)
Name: NF0069_high_17
Description: NF0069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0069_high_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 257
Target Start/End: Original strand, 55696590 - 55696838
Alignment:
| Q |
9 |
gataattctatgtgcagtcaaatcaaaaccagtttctttccagattgcaggtatgttcaccaagtaccaaaactagagccaatatgttcttgggtaatga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55696590 |
gataattctatgtgcagtcaaatcaaaaccagtttctttccagattgcaggtatgttcaccaagtaccaaaactagagccaatatgttcttgggtaatga |
55696689 |
T |
|
| Q |
109 |
ctttaagtcgagcttgcatgacaggcatagatgaataagctgggaaacacagccgacaaaagcatgtatgagatgaaggaaaacgatccccagattcatg |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
55696690 |
ctttaagacgagcttgcatgacaggcatagatgaataagctgggaaacacagccgataaaagcatgtatgagatgaaggaagacgatcaccggattcatg |
55696789 |
T |
|
| Q |
209 |
ggacttgtaaatgtggagacgggaacccaaaccacgaaagccttcaact |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55696790 |
ggacttgtaaatgtggagacgggaacccaaaccacgaaagccttcaact |
55696838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1310 times since January 2019
Visitors: 1296