View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0069_low_22 (Length: 248)
Name: NF0069_low_22
Description: NF0069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0069_low_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 36 - 248
Target Start/End: Original strand, 6486105 - 6486317
Alignment:
| Q |
36 |
gaagaccttttgaccggatattatgattgctttcaccagtccactgttggatttgaatccgcaatattcttgaagattcttccacacacgaatgttcttg |
135 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486105 |
gaagatcttttgaccggatattatgattgctttcaccagtccactgttggatttgaatccgcaatattcttgaagattcttccacacacgaatgttcttg |
6486204 |
T |
 |
| Q |
136 |
ctgtctgaaccggtgtataataagtcaccggaagcggctaaagaataaatgtgaccctcttcgcgaacctgtgaaccgattagtgaattctgtggaggtg |
235 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||| | |
|
|
| T |
6486205 |
ctgtctgagccggtgtataataagtcaccggatgcggctaaagaataaatgtgaccctcttcgcggaccagtgaaccaattagtgaattctgtggaggcg |
6486304 |
T |
 |
| Q |
236 |
tgtcttcatgttg |
248 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6486305 |
tgtcttcatgttg |
6486317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 201
Target Start/End: Original strand, 25703316 - 25703390
Alignment:
| Q |
127 |
atgttcttgctgtctgaaccggtgtataataagtcaccggaagcggctaaagaataaatgtgaccctcttcgcga |
201 |
Q |
| |
|
||||| ||||| || | |||||||||||| | |||||||||| ||||||| || || |||||||| ||||||||| |
|
|
| T |
25703316 |
atgtttttgctatcggtaccggtgtataacatgtcaccggaaacggctaaggagtagatgtgaccttcttcgcga |
25703390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 158
Target Start/End: Original strand, 6917655 - 6917703
Alignment:
| Q |
110 |
gattcttccacacacgaatgttcttgctgtctgaaccggtgtataataa |
158 |
Q |
| |
|
|||||||||| ||||||||||| || || || ||||||||||||||||| |
|
|
| T |
6917655 |
gattcttccaaacacgaatgtttttactatcagaaccggtgtataataa |
6917703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University