View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0069_low_24 (Length: 237)
Name: NF0069_low_24
Description: NF0069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0069_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 8 - 203
Target Start/End: Original strand, 17809767 - 17809972
Alignment:
Q |
8 |
ccacaatgtgagaaaggaaacataagtgtttcaactaaagtgaacttgtccataatgtgcagtaaaagagaatctcatttaacctctttgatctgaccta |
107 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
17809767 |
ccacaacgtgagaaaggaaacataagtgtttcaactaaagtgaacttgtccataatgtgcagtaaaagagaatctcatttaacatctttgatctgaccta |
17809866 |
T |
 |
Q |
108 |
tcacaagtacaatataacccattcatataactaaaacaaaatattagagagttgcagtagaagggaaat----------gagtaaattggtaatctttta |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
17809867 |
tcacaagtacaatataacccattcatataactaaaacaaaatattagagagttgcactagaagggaaatcaaatcattagagtaaattggtaatctttta |
17809966 |
T |
 |
Q |
198 |
agaata |
203 |
Q |
|
|
|||||| |
|
|
T |
17809967 |
agaata |
17809972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 114 - 162
Target Start/End: Original strand, 17813017 - 17813066
Alignment:
Q |
114 |
gtacaatataacccattcatataa-ctaaaacaaaatattagagagttgc |
162 |
Q |
|
|
||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
T |
17813017 |
gtacaatataatccattcatataaactaaaacaaaatattagagagttgc |
17813066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 86
Target Start/End: Original strand, 17812931 - 17813002
Alignment:
Q |
15 |
gtgagaaaggaaacataagtgtttcaactaaagtgaacttgtccataatgtgcagtaaaagagaatctcatt |
86 |
Q |
|
|
||||||||||||| ||||| |||||||||||||| || | || ||||||||| |||| || |||||||||| |
|
|
T |
17812931 |
gtgagaaaggaaaaataagagtttcaactaaagtaaagtagttcataatgtgtagtagaaaggaatctcatt |
17813002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 862 times since January 2019
Visitors: 1285