View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0070_low_7 (Length: 300)

Name: NF0070_low_7
Description: NF0070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0070_low_7
NF0070_low_7
[»] chr2 (1 HSPs)
chr2 (30-101)||(32228236-32228307)


Alignment Details
Target: chr2 (Bit Score: 72; Significance: 9e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 30 - 101
Target Start/End: Complemental strand, 32228307 - 32228236
Alignment:
30 agaaatacatcattttgtagaggattggttactttcgtgtcgcaaaagttggaattaaggacaaagaatgag 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32228307 agaaatacatcattttgtagaggattggttactttcgtgtcgcaaaagttggaattaaggacaaagaatgag 32228236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University